Corso di Formazione Siracusa 28 maggio 2005 La Biologia Molecolare nel Laboratorio di Patologia Clinica Geni e Malattie Dipartimento di Scienze Biomediche.

  • Published on
    02-May-2015

  • View
    213

  • Download
    1

Transcript

  • Slide 1
  • Corso di Formazione Siracusa 28 maggio 2005 La Biologia Molecolare nel Laboratorio di Patologia Clinica Geni e Malattie Dipartimento di Scienze Biomediche Sezione di Biologia generale, cellulare e di Genetica molecolare Universit di Catania Cinzia Di Pietro
  • Slide 2
  • GCGGCGGCGGGCGGGTACTGGCTTCTGGGGCCAGGGGCCAGGGGCGGTGGGCGCCGGGACCGCGGAGCTGAGGA GCGGGGCCCGGCCAGGGCTGGAGACTTTGCGCCCGGGGGCACCGGGGCTGCGCGCGGTCGCACACATCCACCGGC GCGGCTTCCCTCGGCGGCCCGGGCTCCGCTCATCCTGCGGCGGGCGGCGCCGCTCAGGGGCGGGAAGAGGAGGCG GTAGACGCGACCACAGAAGATGTCGGGCCAAACGCTCACGGATCGGATCGCCGCCGCTCAGTACAGCGTTACAGGCT CTGCTGTAGCAAGAGCGGTCTGCAAAGCCACTACTCATGAAGTAATGGGCCCCAAGAAAAAGCACCTGGACTATTTGAT CCAGGCTACCAACGAGACCAATGTTAATATTCCTCAGATGGCCGACACTCTCTTTGAGCGGGCAACAAACAGTAGCTGG GTGGTTGTGTTTAAGGCTTTAGTGACAACACATCATCTCATGGTGCATGGAAATGAGAGATTTATTCAATATTTGGCTTC TAGAAATACACTATTCAATCTCAGCAATTTTTTGGACAAAAGTGGATCCCATGGTTATGATATGTCTACCTTCATAAGGCG CTATAGTAGATATTTGAATGAAAAGGCTTTTTCTTACAGACAGATGGCCTTTGATTTTGCCAGGGTGAAGAAAGGGGCC GATGGTGTAATGAGGACAATGGCTCCCGAAAAGCTGCTAAAGAGTATGCCAATACTACAGGGACAAATTGATGCACTGC TTGAATTTGATGTGCATCCAAATGAACTAACAAATGGTGTCATAAATGCAGCATTTATGCTTCTTTTCAAAGATCTTATCA AACTTTTTGCTTGCTACAATGATGGTGTTATTAACTTACTCGAAAAGTTTTTTGAAATGAAGAAAGGACAATGTAAAGATG CTCTAGAAATTTACAAACGATTTCTAACTAGAATGACACGAGTGTCTGAATTTCTCAAGGTTGCAGAGCAAGTTGGTATT GATAAAGGTGACATTCCTGACCTCACACAGGCTCCCAGCAGTCTTATGGAGACGCTTGAACAGCATCTAAATACATTAG AAGGAAAGAAACCTGGAAACAATGAAGGATCTGGTGCTCCCTCTCCATTAAGTAAGTCTTCTCCAGCCACAACTGTTAC GTCTCCTAATTCTACACCAGCTAAAACTATTGACACATCCCCACCGGTTGATTTATTTGCAACTGCATCTGCGGCTGTCC CAGTCAGCACTTCTAAACCATCTAGTGATCTCCTGGACCTCCAGCCAGACTTTTCCTCTGGAGGGGCAGCAGCAGCCG CAGCACCAGCACCACCACCACCTGCTGGAGGAGCCACTGCATGGGGAGACCTTTTGGGAGAGGATTCTTTGGCTGCA CTTTCCTCTGTTCCCTCTGAAGCACAGATTTCAGATCCATTTGCACCAGAACCTACCCCTCCTACTACAACTGCTGAAAT TGCAACCACTACTGCTGCCACCGCCGCTGCCACCACCACTACCATTCATCTCTTGCCAGCTTAGTAGGCAATCTTGGAA TTTCTGGTACCACAACAAAAAAGGGAGATCTTCAGTGGAATGCTGGAGAGAAAAAGTTGACTGGTGGAGCCAACTGGC AGCCTAAAGTAGCTCCAGCAACCTGGTCAGCAGGCGTTCCACCAAGTGCACCTTTGCAAGGAGCTGTACCTCCAACCA GTTCAGTTCCTCCTGTTGCCGGGGCCCCATCGGTTGGACAACCTGGAGCAGGATTTGGAATGCCTCCTGCTGGGACAG GCATGCCCATGATGCCTCAGCAGCCGGTCATGTTTGCACAGCCCATGATGAGGCCCCCCTTTGGAGCTGCCGCTGTAC CTGGCACGCAGCTTTCTCCAAGCCCTACACCTGCCAGTCAGAGTCCCAAGAAACCTCCAGCAAAGGACCCATTAGCGG ATCTTAACATCAAGGATTTCTTGTAAACAATTTAAGCTGCAATATTTGTGACTGAATAGGAAAATAAATGAGTTTGGAGAC TTCAAATAAGATTGATGCTGAGTTTCAAAGGGAGCCACCAGTACCAAACCCAATACTTACTCATAACTTCTCTTCCAAAAT GTGTAACACAGCCGTGAAAGTGAACATTAGGAATATGTACTACCTTAGCTGTTATCCCTACTCTTGAAATTGTAGTGTAT TTGGATTATTTGTGTATTGTACGATGTAAACAATGAATGGATGTTACTGATGCCGTTAGTGCTTTTTTGGACTTCACCTGA GGACAGATGATGCAGCTGTTGTGTGGCGAGCTATTTGGAAAGACGTCTGTGTTTTTGAAGGTTTCAATGTACATATAAC TTTTGAACAAACCCCAAACTCTTCCCATAAATTATCTTTTCTTCTGTATCTCTGTTACAAGCGTAGTGTGATAATACCAGA TAATAAGGAAAACACTCATAAATATACAAAACTTTTTCAGTGTGGAGTACATTTTTCCAATCACAGGAACTTCAACTGTTG TGAGAAATGTTTATTTTTGTGGCACTGTATATGTTAAGAAATTTTATTTTAAAAAATATAAAGGTTAACGTCCATAATAAAT ACTTCTCTTTGAAGCTACCTTATCAAGAACGAAAAATCGTATGGGAAGAATCCCCTATTTATCACTGCTATATTAAAATAT ATATATTTTAATTATATTTGACAGGTTTTGCATCTAAATTGACCTATTTATTCATTCTTGATTAAATGCACTGAAAAGTAAAA TTTAAAAGTGGTTGTATCTGAATTTACTGTGGGGATAACATACACTGTAATGGGGAAAAATTACCTAAAACCAATTTCAAA ATGGCTTTCTTTGTATTTCAGTTTAAAAACCCAGTGCATGTACGCCCTCTGAGATGCAATAAACACCTTGAACAAAG 3*10 9 bp 150*10 6 bp 1-5*10 6 bp
  • Slide 3
  • Proteine costitutive Indispensabili per la sopravvivenza La loro concentrazione deve rimanere costante Proteine adattative Cambiamenti delle condizioni ambientali Produrre risposte metaboliche a specifici segnali Proteine del differenziamento Assunsione ed espressione permanente di nuove funzioni specifiche Fenotipo
  • Slide 4
  • Slide 5
  • Slide 6
  • In molecular terms, a gene commonly is defined as the entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide. Lodish et al. 2003 Molecular Cell Biology
  • Slide 7
  • Slide 8
  • Slide 9
  • In molecular terms, a gene commonly is defined as the entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide. According to this definition, a gene includes more than the nucleotides encoding the amino acid sequence of a protein, referred to as the coding region.
  • Slide 10
  • Nei geni degli eucarioti gli enhancers possono distare dalla regione codificante anche pi di 50 Kb. Enhancers
  • Slide 11
  • La struttura primaria delle proteine Presenza o assenza della proteina in un determinato tipo cellulare o in un determinato momento della vita cellulare Destinazione delle proteine allinterno della cellula La struttura primaria di RNA non tradotti Il Genoma cellulare specifica :
  • Slide 12
  • Alcune sequenze di DNA sono trascritte in RNA che non codifica proteine (e.g., tRNAs, rRNAs, miRNAs)
  • Slide 13
  • Slide 14
  • Geni di I classe Geni di II classe Geni di III classe rRNA 28S, rRNA 18S, rRNA 5.8S mRNA, U1, U2, U4, U5 snRNAs rRNA5S, tRNA, snRNAU6, scRNAs
  • Slide 15
  • Un genepi catene polipeptidiche
  • Slide 16
  • Slide 17
  • Slide 18
  • Variazioni della sequenza nucleotidica correlate ad alterazioni del fenotipo cellulare Mutazioni
  • Slide 19
  • Variabilit Genetica Evoluzione
  • Slide 20
  • Variazioni della sequenza nucleotidica correlate ad alterazioni del fenotipo cellulare Malattie genetiche Ad eredit mendeliana Talassemia, falcemia, fibrosi cistica Fenotipi complessi Neoplasie, malattie degenerative
  • Slide 21
  • Slide 22
  • Mutazioni somatiche e germinali
  • Slide 23
  • Oncogeni Geni che controllano la proliferazione, il differenziamento cellulare e lapoptosi Geni che controllano la stabilit del genoma Metabolismo cellulare
  • Slide 24
  • Mutazioni geniche Variazioni di una singola coppia di basi (single nucleotide polymorphisms SNPs) o di alcune coppie di basi in un tratto della molecola di DNA.
  • Slide 25
  • Le mutazioni geniche che determinano una variazione quantitativa o qualitativa di una proteina possono causare la comparsa di un fenotipo patologico
  • Slide 26
  • Le conseguenze che una mutazione genica avr sullorganismo dipendono: Da quanto cambiata la sequenza aminoacidica della proteina; Dalla variazione della sua concentrazione intracellulare
  • Slide 27
  • Extragenica Promotore Introni Siti di splicing Sequenza codificante Localizzazione
  • Slide 28
  • CDS
  • Slide 29
  • Tipo di mutazione Sostituzione (silent, synonymous, missense nonsense) Inserzione o Delezione (frameshift mutations)
  • Slide 30
  • Slide 31
  • Slide 32
  • Slide 33
  • Scientists are now learning that many polymorphisms actually do affect a person's characteristics, though in more complex and sometimes unexpected ways. SNP Single nucleotide polymorphism
  • Slide 34
  • Variations Causing Latent Changes They may also explain why one person responds to a drug treatment while another does not. Finally, there are genetic variations that have "latent" effects. These variations, found in coding and regulatory regions, are not harmful on their own, and the change in each gene only becomes apparent under certain conditions. Such changes may eventually cause some people to be at higher risk for cancer, but only after exposure to certain environmental agents.
  • Slide 35
  • Slide 36
  • Autosomal X- Linked Y- Linked Mitochondria l Total * Gene with known sequence 96324364837 1015 3 + Gene with known sequence and phenotype 3653500400 # Phenotype description, molecular basis known 15661442261738 % Mendelian phenotype or locus, molecular basis unknown 1341133401478 Other, mainly phenotypes with suspected mendelian basis 2131150202283 Total 150358985663 1605 2 OMIM Statistics for May 18, 2005
  • Slide 37
  • Identificazione e Caratterizzazione di Oncogeni
  • Slide 38
  • Cancer Genome Anatomy Project
  • Slide 39
  • Dividere la popolazione in gruppi in base a specifici profili di SNPs e ricercare le associazioni con la risposta a specifiche terapie
  • Slide 40
  • Human Genome Project 1990 2001 20?? Principale Obiettivo: Studio delle malattie genetiche Determinare la sequenza completa del genoma umano e conservare questa informazione nei data-bases; Identificare tutti i geni presenti nel DNA di Homo sapiens sapiens; Ideare e/o migliorare i tools per lanalisi dei dati; Applicazioni biotecnologie
  • Slide 41
  • Tutte le malattie hanno una componente genetica, oltre alle classiche malattie genetiche, la risposta a stress ambientali, a virus a tossine dipendono dal genoma individuale. Variazioni della sequenza del genoma quindi causano o contribuiscono allinsorgenza di malattie.
  • Slide 42
  • Diagnosi Cura Prevenzione
  • Slide 43
  • carrier screening, which involves identifying unaffected individuals who carry one copy of a gene for a disease preimplantation genetic diagnosis prenatal diagnostic testing newborn screening presymptomatic testing for predicting adult-onset disorders such as Huntington's disease presymptomatic testing for estimating the risk of developing adult-onset cancers and Alzheimer's disease confirmational diagnosis of a symptomatic individual forensic/identity testing
  • Slide 44
  • Identificare nuovi farmaci per la cure di specifiche malattie Farmacogenomica Terapia Genica Terapia
  • Slide 45
  • Slide 46
  • Slide 47
  • Identificazione di mutazioni di tumor suppressor genes che predispongono allinsorgenza di neoplasie Prevenzione
  • Slide 48
  • International Human Genome Sequencing Consortium Nature ottobre 2004
  • Slide 49
  • A B D Genes Functions C
  • Slide 50
  • This form of combinatorial coding endows an organism with n genes to create, in theory, 2 n different cell-specific gene batteries. This rationalization provides an easy explanation for the fact that the absolute number of genes in a genome does not correlate with organismal complexity Create cellular complexity by differential genes expression Hobert (2004) TIBS
  • Slide 51
  • Slide 52
  • International Human Genome Sequencing Consortium Nature ottobre 2004
  • Slide 53
  • Conserved non genic sequence Emmanouil et al. (2005) Nature Reviews Genetics
  • Slide 54
  • Conserved non genic sequence
  • Slide 55
  • Prossimi obiettivi da raggiungere Identificazione di tutti i polimorfismi genetici della popolazione umana, per facilitare lo studio della loro associazione con fenotipi patologici Identificazione di tutti gli elementi funzionali del genoma umano, cio geni, proteine di regolazione dellespressione genica, sequenze regolatrici e sequenze strutturali.
  • Slide 56
  • Proteoma Interactoma Genoma Proteoma
  • Slide 57
  • Mappa delle principali vie di segnalazione importanti per il cancro in cellule umane. Indica le posizioni cellulari di alcune proteine modificate da mutazioni e coinvolte nella patogenesi di tumori.
  • Slide 58
  • Slide 59
  • Ruolo fondamentale della Biologia in Medicina
  • Slide 60
  • More Powerful Medicines Better, Safer Drugs the First Time More Accurate Methods of Determining Appropriate Drug Dosages Better Vaccines Improvements in the Drug Discovery Decrease in the Overall Cost of Health Care
  • Slide 61
  • Terapia genica

Recommended

View more >